readSeqELANDPaired {seqCBS} | R Documentation |
Read datasets with paired-end format, possible output format of ELAND
readSeqELANDPaired(filename)
filename |
The file name of the data set |
This format has two reads per line, each looking like "NACGATGAAACCCCGTCTCTACTAACCATACAAAAA hs_ref_chr17.fa 12091150 R TGTCGCCCAGGCTGCAATGCAGTGGCGCGATCTCGG hs_ref_chr17.fa 12091018 F". There are 8 columns, 4 for each of the paired read. The first is the actual read sequence, which we discard; the second is the chromosome of the mapped read; the third is the read position; and the last is indicating whether it is a front- or rear- end read. We only use the reads with the same mapped chromosome and only the front read. This contains more information than needed; the Chiang format is prefered.
seqF |
Read position for each read |
seqChr |
Chromosome of each mapped read |
Jeremy J. Shen